Much progress has been made in this area during the last decade when genomic and proteomic data from cellular proteins are compared. In the case of secreted proteins, especially those expressed by multiple tissues, such connections are even harder to make

spectra confidently assigned to that protein. Peptides were considered not quantifiable if they were shared across multiple subgroups of a protein or the precursor ions had a poorly defined isotope cluster. Proteins were considered not quantifiable if there were fewer than two distinct peptides observed in SB-590885 site either the control or cKO samples. Since equivalent amounts of total protein were loaded in each lane of the gel, and both samples were subsequently treated equivalently, no further normalization was done when calculating protein abundance ratios between the two samples. The peak area for the XIC of each precursor ion subjected to MS/MS was calculated automatically by the Spectrum Mill software in the intervening high-resolution MS1 scans of the LC-MS/MS runs using narrow windows around each individual member of the isotope cluster. Peak widths in both the time and m/z domains were dynamically determined based on MS scan resolution, precursor charge, and m/z subject to quality metrics on the relative distribution of the peaks in the isotope cluster vs. theoretical. Although the determined protein ratios are generally reliable to within a factor of two-fold of the actual ratio, numerous experimental factors contribute to variability in the determined abundance for a protein. These factors may include incomplete digestion of the protein; widely varying response of individual peptides due to inherent variability in ionization efficiency as well as interference/suppression by other components eluting at the same time as the peptide of interest, differences in instrument sensitivity over the mass range analyzed, and inadequate sampling of the chromatographic peak between MS/ MS ” scans. Quantitative RT-PCR primers mus mus mus mus mus mus mus mus mus AC1: cagcaggaaccaaggctaag; tggccacattgactgtgttt AC3: tgaggagagcatcaacaacg; tggtgtgactcctgaagctg AC8: ggactgtccccagagaaaca; cttactcccgtgctgtccat pde1A: catgattgggttccatgttg; cagccaactctttccacctc pde1b: tgcccttctctccactctgt; tgggctgacttttaggcttg PDE2A: gaccgatggagatgatggac; acttgtgggacaccttggtc PDE4D1: tatgaaggagcagccctcatg; ccaggacatcttcctgctctg PDE4D4: tggccagtttctggtaggcctc; gagctacccgtggtcgctac PDE4D6: ccaggacatcttcctgctctg; cacattttagaacttgctgtcac September 2011 | Volume 6 | Issue 9 | e25735 Cdk5, Synaptic Plasticity, and Behavior mus PDE4D7: tggccagtttctggtaggcctc; actactcaaaaccgcaccatgg mus PDE4B: ggaaaaatcccaggttggtt; cagtccctgctcctctcatc Supporting Information line, denoted as Cdk5f/f/KA1) were crossed to the reporter line R26Sor. Scale bar = 1 mm. B. the generation of Cdk5f/f/KA1 mice in which Cdk5 is depleted in hippocampal area CA3. C. Immunostaining for Cdk5 in areas CA3 and DG of control mice Cdk5f/f and Cdk5f/f/KA1. Scale bar = 100 mm. D. Swimming speeds for Cdk5f/f and Cdk5f/f/KA1 mice. No significant differences were observed. Examination of neuronal morphology and cell death in Cdk5 mutant mice. A. Cdk5f/f and Cdk5f/ f/CW2 mice were stained with DAPI and imaged in area CA1 of the hippocampus, the cortex, and thalamus. No overall differences in neuronal morphology or cell death were observed. Scale bars, 100 mm. B. Immunoblots from Cdk5f/f and Cdk5f/f/T29 microdissections of area CA1 of “ 24786787 the hippocampus do not reveal any activated cell death markers as assayed by cleaved caspase-3. Acknowledgments We thank Dr. Susumu Tonegawa for the T29-2, KA-1, and CW2 Cre mouse lines, Drs. Yasunori Hayashi, Kensuke Futai, Zhanyan Fu, Wenting Wang and Ji Hu for advice on electrophysiology experime